Mutations
in parC of Borrelia burgdorferi Confer Resistance to Fluoroquinolones
Fellow- Kendal M. Galbraith
The University of Montana IBS-CORE Program
D. Scott Samuels
Introduction
Borrelia burgdorferi, a bacterium in the spirochete phylum, is the
causative agent of Lyme disease (2, 4, 18, 19). About 14,000 cases of Lyme disease are reported each year but the
actual number of cases may be as much as 10-fold higher (23). It has an usual genome consisting of predominately linear DNA in
addition to a few of the more typical circular plasmids that are normally found
in bacteria (3, 6, 8, 9).
DNA
gyrase and topoisomerase IV are prokaryote-specific enzymes that are type II
topoisomerases, a group of enzymes that alter DNA topology by breaking and
resealing both strands of the double helix.
DNA gyrase maintains negative supercoiling in the cell, and Topo IV
decatanates daughter DNA after replication (11, 20). DNA gyrase and Topo IV are tetramers composed of two A subunits
and two B subunits. The A subunits are
involved in the double-stranded nicking and resealing reactions, while the B
subunits are responsible for providing energy through ATP hydrolysis (14). Both DNA gyrase and Topo IV are found in B. burgdorferi (8, 16, 17).
Fluoroquinolones
are chemotherapeutic agents that target type II topoisomerases by preventing
the resealing step in the topoisomerase mechanism (7, 12). This results in lethal
double-stranded DNA breaks (10, 22). Resistance to
fluoroquinolones in other bacteria is usually mapped to
fluoroquinolone-resistance-determining regions (QRDRs) that are found in the A
subunits of DNA gyrase and Topo IV encoded by gyrA and parC,
respectively (7, 21). First-step mutations in one of these genes indicates the primary
target of fluoroquinolones in that bacterium.
Gram-positive bacteria tend to have Topo IV as the primary target, while
gram-negative bacteria tend to have a primary target of DNA gyrase, although
this also depends on the particular fluoroquinolone (1, 5, 7, 13). Knowing the primary target of a fluoroquinolone antibiotic and
why it is sensitive could lead to development of more effective antibiotics, or
new antibiotics that target both subunits equally thus having a reduced
probability of resistance in bacteria.
We
have isolated fluoroquinolone-resistant first-step mutants of B. burgdorferi by selection in
increasing doses of three different fluoroquinolones. This study provides the first example of
fluoroquinolone-resistance mapping studies in the spirochete phylum.
Materials and
Methods
Selection of fluoroquinolone-resistant mutants
High-passage
B. burgdorferi B31 (the type species,
ATCC 35210) was grown at 34°C in Barbour-Stoenner-Kelly
(BSK) H medium. The IC50
(the concentration at which 50% of growth is inhibited) of the fluoroquinolones
moxifloxacin, ciprofloxacin, sparfloxacin and Bay Y3118 were determined for
wild-type B31 via susceptibility assay essentially as described previously (16). These fluoroquinolones were generously provided by Peter Heisig
(Institute of Pharmacy, University of Hamburg). The IC50 concentrations were then added directly to
B31 cultures. Each culture was visually
evaluated for growth and morphology after seven days, and growing cultures were
then passed 1:10 into double the IC50 of the respective
fluoroquinolone. Stagnant cultures were
continually passed into the same antibiotic concentration until growth was
observed by dark-field microscope. When
each culture was growing at 16-fold the wild-type IC50, they were
plated on solid medium containing 10-fold the IC50, as previously
described (15). Five isolated colonies were selected from each plate.
DNA
was isolated from fluoroquinolone-resistant B.
burgdorferi as described previously (17). The region of the gyrA
gene containing the QRDR was amplified, using PCR with gyrB 1885F (5'
GTAATTAATCTTGATGTGTAA) and gyrA 538R (5' TTCCAACAGCAATTCCAC) as primers. The region of the parC gene containing the QRDR of Topo IV was also amplified, using
PCR with parC 68F ( 5' CTATTGCTAGT-GTTGTTGATGGG) and parC 311R ( 5'
CTAGAAGCAGAAGCAGGATCAC).
Results
All
sequences of the 570 base pair gyrA
region were found to be identical to wild-type B31. Mutants selected in Bay-Y3118 contained one of two
mutations. Mutant T69K was 8-fold more
resistant to this fluoroquinolone than parental B31, and was found to have a C
to A change at nucleotide 206 in the parC
gene that resulted in a Thr-to-Lys amino acid change (at position 69). S70P has a mutation from a T to a C at
nucleotide 208 in the parC gene resulting
in a Ser-to-Pro amino acid change (at position 70). E73G, selected in moxifloxacin, is 13-fold more resistant than
B31. It has an A to G mutation at
nucleotide 218 in the parC gene that
resulted in a Glu-to-Gly amino acid change (at position 73). Finally E73K, selected in sparfloxacin and
75-fold more resistant than wild-type B31, had a mutation of a G to an A at
nucleotide 219 of parC resulting in a
Glu-to-Lys amino acid change (at position 73).
Table 1 shows resistance data of these mutants to fluoroquinolones. The growth rate, morphology and plasmid
content in the variants selected were indistinguishable from those of wild-type
B31.
Table
1: Resistance of
fluoroquinolone-resistant mutants.
Conclusions
and Discussion
Fluoroquinolones
are potent chemotherapeutic agents that target the A subunit of both DNA gyrase
and Topo IV. We have isolated
first-step fluoroquinolone-resistant mutants of B. burgdorferi and have mapped single-point mutations to the QRDR
of the parC gene encoding the A
subunit of Topo IV. This indicates that
the primary target of the fluoroquinolones moxifloxacin, sparfloxacin and
Bay-Y3118 in B. burgdorferi is Topo
IV. This is the first example of a
mutation in a spirochete that confers resistance to fluoroquinolones.
B. burgdorferi is somewhat naturally
resistant to fluoroquinolones and we hypothesize this is due to the presence of
a glutamine at position 86 in GyrA, a
highly conserved position occupied by a serine residue in almost all species
(See Figure 1 below). In E. coli, a
single mutation of S83L (homologous to Q86 of B. burgdorferi) in GyrA results in 32-fold resistance. We are currently selecting for second site
mutations that confer higher levels of resistance as well as selecting for mutations
in other fluoroquinolones, including ciprofloxacin.
Figure
3: Alignment of QRDRs of E. coli (Ec), S. pneumoniae (Sp), and
B. burgdorferi (Bb) ParC, and GyrA proteins. Row 1-6 shows amino acid residues 82-95,
67-79, 81-93, 56-68, 79-91, and 76-89 for each respective protein. The bottom row represents the consensus
sequence for all the proteins. We
hypothesize the Q residue at position 86 of Bb GyrA is responsible for B. burgdorferi's natural resistance to
fluoroquinolones.
Acknowledgements
This work was funded in part by an IBS-CORE Undergraduate Research
Fellowship to Kendal Galbraith through a grant from the Howard Hughes Medical
Institute to The University of Montana.
Kendal has also received internships from the Davidson Honors
College. We thank Betsy Kimmel and
Christian Eggers for advice and assistance and Peter Heisig for providing
fluoroquinolone antibiotics. Work in
the Samuels laboratory in funded by the National Science Foundation, Arthritis
Foundation and National Institutes of Health.
References
1. Bagel, S., V. Hullen,
B. Wiedemann, and P. Heisig. 1999. Impact of gyrA and parC mutations
on quinolone resistance, doubling time, and supercoiling degree of Escherichia coli. Antimicrob. Agents
Chemother. 43:868-875.
2. Barbour, A. G., and
D. Fish. 1993. The biological and social phenomenon of Lyme disease.
Science 260:1610-1616.
3. Barbour, A. G., and
C. F. Garon. 1987. Linear plasmids of the bacterium Borrelia burgdorferi have covalently closed ends. Science 237:409-411.
4. Barbour, A. G., and
C. F. Hayes. 1986. Biology of Borrelia species. Microbiol. Rev. 50:381-400.
5. Bebear, C. M., J.
Renaudin, A. Charron, H. Renaudin, B. de Barbeyrac, T. Schaeverbeke, and C.
Bebear. 1999. Mutations in the gyrA,
parC, and parE genes associated with fluoroquinolone resistance in clinical
isolates of Mycoplasma hominis.
Antimicrob. Agents Chemother. 43:954-956.
6. Casjens, S., N.
Palmer, R. Van Vugt, W. M. Huang, B. Stevenson, P. Rosa, R. Lathigra, G.
Sutton, J. Peterson, R. J. Dodson, D. Haft, E. Hickey, M. Gwinn, O. White, and
C. M. Fraser. 2000. A bacterial genome in flux: the twelve linear and nine
circular extrachromosomal DNAs in an infectious isolate of the Lyme disease
spirochete Borrelia burgdorferi. Mol.
Microbiol. 35:490-516.
7. Drlica, K., and X.
Zhao. 1997. DNA gyrase, topoisomerase IV, and the 4-quinolones. Microbiol.
Mol. Biol. Rev. 61:377-392.
8. Fraser, C. M., S.
Casjens, W. M. Huang, G. G. Sutton, R. Clayton, R. Lathigra, O. White, K. A.
Ketchum, R. Dodson, E. K. Hickey, M. Gwinn, B. Dougherty, J.-F. Tomb, R. D.
Fleischmann, D. Richardson, J. Peterson, A. R. Kerlavage, J. Quakenbush, S.
Salzberg, M. Hanson, R. van Vugt, N. Palmer, M. K. Adams, J. Gocayne, J.
Weidman, T. Utterback, L. Watthey, L. McDonald, P. Artiach, C. Bowman, S.
Garland, C. Fujii, M. D. Cotton, K. Horst, K. Roberts, B. Hatch, H. O. Smith,
and J. C. Venter. 1997. Genomic sequence of a Lyme disease spirochete, Borrelia burgdorferi. Nature 390:580-586.
9. Hinnebusch, J., and
K. Tilly. 1993. Linear plasmids and chromosomes in bacteria. Mol.
Microbiol. 10:917-922.
10. Khodursky, A. B., and
N. R. Cozzarelli. 1998. The mechanism of inhibition of topoisomerase IV by
quinolone antibacterials. J. Biol. Chem. 273:27668-27677.
11. Luttinger, A.
1995. The twisted "life" of DNA in the cell: bacterial
topoisomerases. Mol. Microbiol. 15:601-606.
12. Maxwell, A., and S. E.
Critchlow. 1998. Mode of Action, p. 119-166. In J. Kuhlman, A. Dalhoff, and H.-J. Zeiler (ed.), Handbook of
Experimental Pharmacology: Quinolone Antibacterials, vol. 127. Springer-Verlag,
Berlin.
13. Munoz, R., and A. G.
De La Campa. 1996. ParC subunit of DNA topoisomerase IV of Streptococcus pneumoniae is a primary
target of fluoroquinolones and cooperates with DNA gyrase A subunit in forming
resistance phenotype. Antimicrob. Agents Chemother. 40:2252-2257.
14. Reece, R. J., and A.
Maxwell. 1991. DNA gyrase: structure and function. CRC Crit. Rev. Biochem.
Mol. Biol. 26:335-375.
15. Samuels, D. S.
1995. Electrotransformation of the spirochete Borrelia burgdorferi, p. 253-259. In J. A. Nickoloff (ed.), Electroporation Protocols for
Microorganisms, vol. 47. Humana Press, Totowa, New Jersey.
16. Samuels, D. S., and C.
F. Garon. 1993. Coumermycin A1 inhibits growth and induces
relaxation of supercoiled plasmids in Borrelia
burgdorferi, the Lyme disease agent. Antimicrob. Agents Chemother. 37:46-50.
17. Samuels, D. S., R. T.
Marconi, W. M. Huang, and C. F. Garon. 1994. gyrB mutations in coumermycin A1-resistant Borrelia burgdorferi. J. Bacteriol. 176:3072-3075.
18. Steere, A. C.
1994. Lyme disease: a growing threat to urban populations. Proc. Natl. Acad.
Sci. U. S. A. 91:2378-2383.
19. Steere, A. C.
1989. Medical progress: Lyme disease. N. Engl. J. Med. 321:586-596.
20. Wang, J. C. 1996.
DNA topoisomerases. Annu. Rev. Biochem. 65:635-692.
21. Yoshida, H., M.
Bogaki, M. Nakamura, and S. Nakamura. 1990. Quinolone
resistance-determining region in the DNA gyrase gyrA gene of Escherichia coli.
Antimicrob. Agents Chemother. 34:1271-1272.
22. Yoshida, H., M.
Nakamura, M. Bogaki, H. Ito, T. Kojima, H. Hattori, and S. Nakamura. 1993.
Mechanism of action of quinolones against Escherichia
coli DNA gyrase. Antimicrob. Agents Chemother. 37:839-845.
23. Young, J. D. 1998.
Underreporting of Lyme disease. N. Engl. J. Med. 338:1629.
Executive Summary:
Borrelia burgdorferi is a bacterium that causes Lyme disease in North
America. This bacteria is transmitted
by the bite of a tick. These bacteria
have unusual DNA contained in a linear arrangement as well as in a circular
arrangement like most other bacteria.
Antibiotics are drugs used to kill bacteria. We are studying the ability of B. burgdorferi to become resistant to a particular group of
antibiotics known as the fluoroquinolones.
We have found that fluoroquinolone-resistant B. burgdorferi have mutations in the gene that encodes an important
replication enzyme known as topoisomerase IV (Topo IV), indicating that
fluoroquinolones target Topo IV preferentially in the cell. Studying how B. burgdorferi gains resistance to fluoroquinolones can be useful
in developing new antibiotics to treat B.
burgdoferi infection.