Characterizing the binding
site of the Hbb protein from Borrelia
burgdorferi
Fellow- Corbin M. Schwanke
The University of Montana IBS-CORE Program
Introduction:
Borrelia burgdorferi, the causative agent of Lyme disease (Burgdorfer, et al., 1982), is unusual in that its genome is composed of a linear chromosome and both linear and circular plasmids (Barbour and Hayes, 1986, Baril, et al., 1989), rather than the more conventional circular genomes found in most bacteria. These linear molecules have covalently closed telomeres that result in hairpin turns at both ends (Barbour and Garon, 1987). Work in our lab focuses on the topology and metabolism of this genome.
The small DNA-binding proteins are common to most bacterial species. Originally discovered as suspected bacterial histone analogs (Pettijohn, 1988), they function in assembly of higher-order nucleoprotein complexes, gene regulation, topological manipulation of DNA, and other metabolic processes involving DNA (Drlica and Rouviere-Yaniv, 1987). When these proteins bind DNA they tend to produce a bend or wrap in the double helix (Figure 1), putting the DNA in a conformation more favorable for binding of other factors (Nash, 1996, Ner, et al., 1994). For this reason they are considered accessory proteins and not direct regulators. The best characterized of this class of proteins are the HU and integration host factor (IHF) proteins from E. coli. HU has been shown to be necessary for replication of E. coli DNA in vitro. It binds near the origin of replication and aids in the assembly of the replicative machinery. IHF is required for lambda phage integration into the E. coli genome, and can substitute for HU in replication initiation (Friedman, 1988). These proteins, although similar in function, differ in the fact that HU is a non-specific DNA binding protein under most circumstances (Aki and Adhya, 1997), whereas IHF binds specifically to a conserved sequence of bases in DNA (Craig and Nash, 1984).
B. burgdorferi contains the small accessory proteins Hbb and Gac. Gac is the C-terminal domain of the A subunit of DNA gyrase that is expressed as a separate transcript and binds DNA non-specifically (Knight and Samuels, 1999). Hbb was discovered based on complementation of E. coli HU and IHF mutants (Tilly, et al., 1996). We have shown that the Hbb protein binds DNA in a sequence-specific manner, like IHF. Experiments have also shown that Hbb binds in the dnaN/dnaA intergenic region, which is the putative origin of replication in B. burgdorferi (Kobryn, et al., 2000). Additional experiments have shown that Hbb puts a large (>126° bend) in DNA, and can alter supercoiling in combination with a topoisomerase (Kobryn, et al., 2000). We have focused our recent research on the promoter region binding activity of Hbb. The protein binds the promoter regions for a number of genes in B. burgdorferi, including those encoding outer surface protein C (OspC), the Gac protein, outer surface proteins A and B (OspA and OspB), and the Hbb protein itself. However, Hbb does not bind in the intergenic space that contains the promoter region for the operon encoding the subunits of DNA gyrase and the gene encoding the DnaA protein, which are on the same intergenic region.
The purpose of this research has been to understand the role that Hbb may play in transcriptional regulation. The first step is to determine a consensus sequence for Hbb binding, based on the binding to the aforementioned promoters.
Materials and Methods:
Electrophoretic mobility shift
assay (EMSA):
PCR products of various lengths were amplified from the promoter regions of gac, ospC/guaA, hbb, gyrBA/dnaA, and ospAB using the primers listed in Table 1. 10 pmol of the primers indicated with an asterisk end labeled with [g-32P]dATP and 25 pmol of the matching primer were used. Labeled DNA at a concentration of 10 nM was incubated at 25°C for 30 min. with the Hbb protein at concentrations of 5, 10, 20, 50, 100, 200, 500, 1000 nM in 10 mM HEPES pH 7.5, 90 mM KCl, 300 µg/ml BSA, and 10% glycerol. These reactions were resolved by 4% polyacrylamide gel electrophoresis and visualized by autoradiography.
Non-Specific Competition EMSAs
Each fragment shown to bind DNA by the above EMSAs was tested for non-specific binding by incubating 10 nM labeled DNA with 40 nM protein in the same binding conditions listed above. Also added was unlabeled DNA PCR amplified from the gyrB gene by the primers gyrB 1F and gyrB 234R. This fragment was used at concentrations of 10, 50, 100, 200 and 500 and nM. These reactions were resolved by 4% polyacrylamide gel electrophoresis and visualized by autoradiography.
Specific Competition EMSAs
Reaction conditions were the same as for the non-specific competition assays, except that the unlabeled gyrB fragment was replaced with unlabeled DNA fragments amplified with the same primers used for the labeled fragments. This unlabeled DNA was added at concentrations of 10, 50, 100, 200, 500, and 1000 nM.
DNase Footprinting:
A PCR product was amplified using 20 pmol of labeled primer, either ospC 95R or gyrA 1213F for the ospC or gac promoter, respectively. The other primer to complete the reaction was ospC U291F for ospC or gyrA 1547R for gac. The product was concentrated and excess radionucleotide removed by ammonium acetate precipitation, and then run on 4% acrylamide gel electrophoresis. The fragment was excised and purified from the gel slice by incubating overnight at 37°C in 500 µl STE (TE + 500 mM NaCl). The supernatant was removed and ethanol precipitated. DNA at 20 nM was then incubated with protein at concentrations of 0, 0, 20, 100 and 1000 nM at conditions the same as those used for the binding reaction in the EMSA assay described above. The first reaction was treated with water, while the second through sixth reactions were treated with DNase at a concentration of 0.1 U/µl for 2 minutes. The reactions were stopped by addition of DNase stop solution (1% SDS, 200 mM NaCl, 20 mM EDTA pH 8.0, 40 µg/ml tRNA). These reactions were then phenol-chloroform extracted, followed by ethanol precipitation. 5 µl of loading buffer (95% v/v formamide, 10 mM EDTA pH 8.0, 0.1% w/v bromophenol blue, 0.1% w/v xylene cyanol) was added to each reaction. The reactions were resolved by electrophoresis on 6% acrylamide gel in 1X TBE buffer on a Sequi-Gen® Sequencing Cell (Bio-Rad). A G+A ladder was run in parallel with the reactions. The G+A ladder was produced using the dsDNA Cycle Sequencing System (Life Technologies) with ospC U1R or gyrA 1213F as the labeled primer. The gel was dried and visualized using a phosphorimager.
Results:
The electrophoretic mobility shift assays performed on the gac, hbb, ospC/guaA, and ospAB promoters showed a shift from a naked DNA band to a protein-DNA complex (Figure 3 and data not shown). The gyrBA/dnaA promoter shifted only at a high protein to DNA molar ratio (Figure 2). The gac promoter showed a shift from the naked DNA band to the protein/DNA complex, and then an additional shift at higher concentrations (Figure 3).
Non-specific competition EMSAs for each fragment with Hbb binding capacity showed gradual shifts from the complexed band back to a level that indicates naked DNA (Figure 4 and data not shown). Specific competition EMSAs showed no shifts from the complexed band back to naked DNA for any of the Hbb binding fragments (Figure 5 and data not shown).
The DNase footprint of the promoter for the ospC gene and guaA gene shows a region of protection of approximately 50 bp (Figure 6), which is comparable to that of the previously discovered dnaA/dnaN binding site (Figure 7). The footprint of the gac promoter also shows a large region of protection (Data not shown).
Discussion:
The EMSAs performed for the ospC/guaA, gac, hbb, and ospAB promoters have shown that Hbb binds all three with different affinities, whereas the gyrBA/dnaA promoters did not bind Hbb. This indicates that Hbb is a specific DNA-binding protein, and that the gyrBA/dnaA promoters lack the binding sequence. The gac promoter EMSA shows a double-shifted complex, which leads us to hypothesize that the fragment contains more than one Hbb-binding site, and that this is not protein-protein interactions that could have also caused a supershift. If protein-protein interactions were occurring, they should have been apparent in all experiments.
The competition assays showed that the binding of Hbb to these fragments is indeed specific. If the binding were non-specific, the protein would eventually have all been bound by the unlabeled competitor and the shifted complex would no longer be visible.
The specific competition assays are used as a reference as to what would happen in the non-specific competition assays if the protein bound the competitor. As the concentration of unlabeled competitor is increased, the visible nucleoprotein complex shifts back to naked DNA once the protein is all bound to unlabeled competitor.
The
footprint of the ospC promoter has
provided an additional sequence for analysis in determining a consensus binding
site for Hbb. When these sequences are
compared using ClustalW alignments, they show a large amount of similarity. Using these sequences, additional alignments
have been performed on the gac, ospAB and
hbb promoter regions, showing each to
have regions of sequence similarity to the two binding sites (Figure 5). The gac
promoter footprint shows a binding site in the region predicted by the
alignments, but lack of sequencing data does not allow concrete proof of the
exact sequence of binding.
Additional experiments need to
be performed before a genuine consensus sequence can be identified, but all
fragments that bind Hbb appear to have a conserved region that is preferred for
Hbb binding. This information could be
used to search the genome for additional binding sites, giving clues as to the
overall function of the Hbb protein.
Acknowledgements:
We thank George Chaconas for generously providing the Hbb protein for these experiments, Scott Knight for valuable input on the EMSA experiments and Craig Kuchel for contributing to the EMSA data. We also appreciate the rest of the members of the Samuels laboratory for their advice and support. This work has been funded in part by an IBS-CORE Undergraduate Research Fellowship to Corbin Schwanke through a grant from the Howard Hughes Medical Institute to The University of Montana. Corbin Schwanke has also received internships from the Davidson Honors College of The University of Montana. Work in the Samuels laboratory is funded by the National Institutes of Health, the National Science Foundation, the Arthritis Foundation and The University of Montana Grants Program.
References:
Aki, T.
and S. Adhya, (1997) Repressor induced site-specific binding of HU for
transcriptional regulation. The EMBO
Journal. 16(12). 3666-3674.
Barbour,
A. and S. Hayes, (1986) Biology of Borrelia
species. Microbiology Review. 50. 381-400.
Barbour,
A.G. and C.F. Garon, (1987) Linear plasmids of the bacterium Borrelia burgdorferi have covalently
closed ends. Science. 237. 409-411.
Baril, C.,
Richaud, C., Baranton, G. and Saint Girons, I., (1989) Linear
chromosome of Borrelia burgdorferi. Research Microbiology. 140(507-516).
Burgdorfer,
W., Barbour, A., Hayes, S., Benach, J., Grunwalt, E. and Davis, J., (1982) Lyme
disease - a tick-borne spirochetosis? Science.
216. 1317-1319.
Craig, N.
and H. Nash, (1984) E. coli
integration host factor binds to specific sites in DNA. Cell. 39. 707-716.
Drlica, K.
and J. Rouviere-Yaniv, (1987) Histonelike Proteins of Bacteria.
Microbiological Reviews. 51(3). 301-319.
Friedman,
D.I., (1988) Integration host factor: a protein for all reasons. Cell. 55(545-554).
Knight, S.
and D. Samuels, (1999) Natural synthesis of a DNA-binding protein from the
C-terminal domain of DNA gyrase A in Borrelia
burgdorferi. EMBO J. 19(17).
4875-4881.
Kobryn,
K., D. Naigamwalla, and G. Chaconas, (2000) Site-specific DNA binding
and bending by the Borrelia burgdorferi
Hbb protein. Molecular Microbiology. 37(July). 145-155.
Nash, H., (1996) The HU and IHF Proteins:
Accessory Factors for Complex Protein-DNA Assemblies, in Regulation of Gene
Expression in Escherichia coli, E. Lin and A. Lynch, (eds). Austin, TX:
R.G. Landes Co. 149-179.
Ner, S.,
A. Travers, and M. Churchill, (1994) Harnessing the writhe: a role for
DNA chaperones in nucleoprotein-complex formation. Trends Biochem Sci. 19.
185-187.
Pettijohn,
D., (1988) Histone-like Proteins and Bacterial Chromosome Structure. J. Biol. Chem. 263(26). 12793-12796.
Rice, P.,
Yang, S, Mizuuchi, K. and Nash, H., (1996) Crystal structure of an
IHF-DNA complex: a protein-induced DNA U-turn. Cell. 87. 1295-1306.
Tilly, K.,
Fuhrman, J., Campbell, J. and Samuels, D.S. (1996) Isolation
of Borrelia burgdorferi genes
encoding homologues of DNA-binding protein HU and ribosomal protein S20. Microbiology. 142. 2471-2479.
Executive Summary:
Borrelia burgdorferi is the bacterium that causes Lyme disease, a multi-symptom disorder that results from the bite of a tick. This bacterium is also interesting because its DNA is in a linear form rather than a circular form like most bacteria. The different aspects of this DNA are a major focus of the work done in our laboratory. Proteins are closely associated with everything that happens to DNA. They can be enzymes that copy or decipher the DNA, they can package DNA, and they can bend, break and reform DNA. One class of proteins, called accessory factors, bends DNA to put it into conformations that are easier for other proteins to bind to. Hbb is one such protein in B. burgdorferi. We have found that Hbb binds DNA at a specific sequence, and that this sequence often occurs in regions of DNA called promoters, which are the major points of regulation of the expression of genes. Our recent work has been to define the sequence of DNA bases that Hbb preferentially binds to.
Figure 1

The IHF protein from Escherichia coli bound to double-stranded DNA (Rice, et. al., 1996). The protein binds in the minor groove and induces a large bend in the DNA strands, as shown in the figure.
Figure 2:

EMSA on the gyrB promoter. Lane 1 has no Hbb added. Hbb concentrations increase in subsequent lanes from 5 to 1000 nM. Band B is naked DNA and A shows where a shifted complex would occur.
Figure 3:

EMSA on the gac promoter. Lane 1 has no Hbb added. Hbb concentrations increase in subsequent lanes from 5 to 1000 nM. Band C is naked DNA, band B is the primary shift with one Hbb molecule bound to one fragment of DNA, and band C is the supershift putatively caused by two Hbb molecules bound to the same DNA fragment.
Figure 4:

Non-specific competition assay using the gac promoter. Lane 1 is labeled DNA with no Hbb added. Lane 2 is labeled DNA with Hbb at a 4:1 protein to DNA ratio. Non-specific competitor was added in increasing concentrations from lane 3 to lane 7 (10 to 500 nM). Band A is the supershifted complex of the gac promoter with two Hbb molecules bound and band B is naked DNA. The original shift is not affected by the addition of unlabeled non-specific DNA.
Figure 5:

Specific competition assay using the gac promoter. Lane 1 is labeled DNA with no Hbb added. Lane 2 is labeled DNA with Hbb at a 4:1 protein to DNA ratio. Non-specific competitor was added in increasing concentrations from lane 3 to lane 8 (10 to 1000 nM). Band A is the supershifted complex of the gac promoter with two Hbb molecules bound, band B is the primary shift with one protein molecule per DNA strand, and band C is naked DNA. The original shift is negated by the addition of unlabeled DNA, which eventually out-competes all labeled DNA, resulting in the naked DNA band in lane 8.
Figure 6:

DNase I footprint of the ospC promoter. Lane 1 is end-labeled DNA with no protein or DNase added. Lane 2 is end-labeled DNA treated with DNase. Lanes 3 through 5 have Hbb added at increasing concentrations (20-1000 nM). The box indicates the area of protection provided by the bound protein.
Figure 7:

ClustalW alignment of Hbb binding sites. Promoters are listed on the left side, and the bottom line indicates the consensus sequence for Hbb binding.
Table 1:
|
Primer |
Sequence (5’ —> 3’) |
Fragment |
|
ospC U1R* |
ATAAGTCCTAGAATAAATTAA |
ospC promoter (EMSA) |
|
ospC U232F |
TAATTTGTGCCTCCTTTTTAT |
ospC promoter (EMSA) |
|
ospC 95R* |
GAATTTGCAGATGTATTCC |
ospC promoter (Footprint) |
|
ospC U291F |
ATTAGTTGGCTATATTGGG |
ospC promoter (Footprint) |
|
gyrA 1213F* |
AAAGATGCAAGGGAGAGGC |
gac promoter |
|
gyrA 1547R |
CCTTTCTTTGTAAGCATAACAAC |
gac promoter |
|
gyrB 1F |
ATGAATTATGTTGCTAGTAACATT |
gyrB fragment |
|
gyrB 234R |
ATCGGTAGGAATNNNTCTCCCATTATC |
gyrB fragment |
|
osp 1* |
AAGCTTAATTAGAACCAAAC |
ospAB promoter |
|
osp 18 |
GGCTAATATTAGACCTATTCCC |
ospAB promoter |
|
gyrB 84R* |
AACTGAGCCTATATACATGCCAGG |
gyrB/dnaA promoters |
|
dnaA 24R |
CCATATATTTTTTGATTTTTCCAT |
gyrB/dnaA promoters |
|
rpsT U182F* |
GAAAATCATCAGACAAAAAAGG |
hbb promoter |
|
rpsT 74R |
TTTTACACTTACATTTCTAATCTTTC |
hbb promoter |
The primers used in footprinting and electrophoretic mobility shift assay experiments.